Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) A flowchart of the chemical screen demonstrating the major steps. ( B ) Raw data of cell size and cell cycle stage measured from a single control well in the screen. The scatter plot represents single-cell measurements of cell size and three markers of cell cycle stage; Cdt1 (mKO2-hCdt1), Geminin (mAG-hGem) and DNA (DAPI). Every point in the plot represents measurements on one single cell. Cell size is represented by a color scheme depicted by the colorbar on the right. White arrows are added to guide the reader along the cell cycle trajectory. ( C ) Average size of early G1 cells is negatively correlated with the fraction of cells in early G1. The scatterplot displays the result from one example 384-well plate. Each point on the plot corresponds to one particular screened condition (screened compound or control), and represents the average size of early G1 cells in that condition versus the proportion of cells in G1. Red circles highlight the conditions that significantly affect the size of early G1 cells and/or the proportion of cells in G1. The arrows designate examples of on-axis and off-axis compounds (also see ). ( D ) Distribution of correlation coefficients between average size of early G1 cells and the fraction of cells in G1, calculated for all screened plates (as described in Materials and methods - Analysis of the compound screen), demonstrating that the two variables are significantly negatively correlated (p<10 −16 ). ( E, F ) Ranked p-values from the target enrichment analysis of on-axis and off-axis compounds, respectively (Fisher’s exact test). Components of the mTOR pathway and p38 MAPK pathway, which are highlighted, are among the top-ranked hits of on-axis and off-axis phenotypes, respectively. The Matlab script used to perform the target enrichment analysis is presented in . 10.7554/eLife.26947.009 Figure 1—source data 1. The screen metadata used to identify on-axis and off-axis outliers. 10.7554/eLife.26947.010 Figure 1—source data 2. The analysis script to visualize on-axis and off-axis outliers using . 10.7554/eLife.26947.011 Figure 1—source code 1. The Matlab script used to perform the target enrichment analysis.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Components from the p38 pathway (highlighted) were highly enriched. Specifically, MK2/MAPKAPK2, a direct downstream substrate of p38 is the top-ranking genes that associate with increased cell size variability.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques:

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: To estimate the cell size variability that results from inhibition of a specific protein, z-scores were averaged from all screen compounds targeting that protein. An average cell size variability was calculated for each of the target proteins and ranked from small to large. Components of the p38 MAPK pathway (highlighted in red) are ranked among the top proteins with increased z-scores in cell size variability.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Inhibition

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) Quantifying the coordination of cell size and G1 length. Samples of unsynchronized cells were treated with increasing concentrations of rapamycin (a rapamycin concentration series: 0, 0.03, 0.3, 3 and 30 nM) for a period of 24 hr, and then stained and imaged to quantify cell size and cell cycle stage on a single-cell basis. Each data point (circle) corresponds to a different concentration of rapamycin and shows the average size of early G1 cells and the proportion of cells in G1 resulting from that treatment. Populations treated with higher concentrations of rapamycin had smaller cells and higher fractions of cells in G1, resulting in a robust negative correlation. Rapamycin concentrations are redundantly represented by both the size of the circles and their color, as shown in the colorbar. The small white circles represent control populations that were treated with DMSO, rather than rapamycin. Calculation of the average size and the proportion of G1 cells, in each of the represented samples, was performed by classifying single cells into cell cycle stage as depicted in . Each data point was measured from an unsynchronized population with a minimum of 7000 cells. Additional details on the experiment and analysis is provided in the Materials and methods section. ( B ) The experiment described in panel A is repeated with (red) or without (blue) a chemical inhibitor of p38 (SB203580, 5 μM). The negative correlation between the size of early G1 cells and the proportion of cells in G1 is apparent in populations not treated with SB203580 (blue) but not in the populations that are treated with SB203580. The blue and red trend lines represent linear regressions. ( C ) Western-blots of whole cell lysates from populations that were treated with different combinations of SB203580, rapamycin and Torin-2. The experimental procedure used here are the same as those used to generate the data shown in panel A and B. The increased levels of phopho-p38 in the population that is treated with SB203580 (a p38 inhibitor) should not be interpreted as a lack of efficacy of SB203580. Rather, these higher levels of phopho-p38 are explained by a negative feedback in the p38 pathway , and the fact that while p38 inhibitors prevent p-p38 from phosphorylating its downstream substrates, these inhibitors do not block phosphorylation of p38 itself by upstream regulators . ( D ) Inhibition of the p38 MAPK pathway, but not the MAPK/ERK or SAPK/JNK pathways, disrupts the correlation between the average size of early G1 cells and the proportion of cells in G1. Results were obtained with the same assay used to create panel A and B. Larger circle size indicates higher rapamycin concentration. The rapamycin concentration series includes: 0, 0.03, 0.1, 0.3, 3 and 30 nM. The results shown here are representative of three independent experiments. ( E ) Fitted slopes corresponding to the trends shown in . Error bars represent 90% confidence intervals. For each compound treatment, its fitted slope is compared with the slope of the control (DMSO) from the same experiment. Significance was calculated with one-tailed Student’s t -test (H 0 : slope drug <= slope control ). The meta data and source code used for this analysis and visualization of results is presented in . 10.7554/eLife.26947.017 Figure 2—source data 1. Measurements of cell size and cell cycle stages from the chemical inhibitor experiments as shown in , and .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Concentration Assay, Staining, Control, Western Blot, Blocking Assay, Phospho-proteomics, Inhibition, One-tailed Test

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A–C ) Scatterplots displaying relationship between average growth rate in G1 stage with G1 duration for individual cells in DMSO control, p38 inhibition and mTOR inhibition. ( D–F ) Scatterplots displaying relationship between average growth rate over cell cycle with cell cycle duration for individual cells in the three conditions. r indicates Spearman’s correlation coefficient. ( G–I ) Distribution of average growth rate in G1 (before Geminin rise), S/G2 (after Geminin rise) and over the entire cell cycle for the three tested conditions. While mTORC1 inhibition by Rapamycin decreases growth rate, p38 inhibition by SB203580 does not significantly affect growth rate in G1. The meta data and source code used in this analysis is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control, Inhibition

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) Live cells subject to p38 inhibition (SB203580) or to mTORC1 inhibition (rapamycin) were followed with time-lapse microscopy to monitor proliferation over a period of 50 hr. mTOR inhibition significantly slowed rates of proliferation, while p38 inhibition increased rates of proliferation. ( B ) As an alternative method to assay cell cycle lengths, populations of cells were treated with p38 inhibitors and samples were fixed every 20 hr over a period of 3 days (see Materials and methods -Estimation of cell proliferation durations and growth rate from bulk measurements). Proportion of cells in the different cell cycle stages, in each of the collected samples, were calculated based on the cell cycle indicators depicted in . Consistently, p38 inhibitors accelerate proliferation by shortening the duration of G1 but not the durations of S or G2 (also see ). The meta data and source code used for this cell cycle analysis is presented in . ( C–F ) Live cells were imaged by time-lapse microscopy for a period of 50 hr to obtain growth trajectories of single cells over the course of their entire cell cycle. Computer generated image processing and cell tracking were performed, as described in Materials and methods - Automated lineage tracking and analysis, to obtain single cell growth curves. Nuclear size was used as a proxy of cell size, as has been validated in . Cells that were successfully tracked throughout their entire cell cycle were collected to calculate the cell cycle durations and cell size dynamics. ( G–I ) Scatterplots displaying relationship between nuclear size at birth and G1 duration for individual cells that are subject to chemical inhibition of p38 ( H ), chemical inhibition of mTOR ( I ), and a control population treated with DMSO ( G ). Every single point corresponds to the birth size and G1 length of a single live cell that was followed by time-lapse microscopy. Also shown are means and errorbars (SEM) of average G1 length calculated for different cell size bins. The dashed line shows the result of linear regression with the binned data. ( J ) Slopes obtained by the linear regression shown in ( G–I ) Error bars indicate 95% confidence bounds. The results shown here are representative of two independent experiments. The single-cell tracking data from the live-cell imaging experiments and the source code for analysis and visualization of the results is presented in . 10.7554/eLife.26947.022 Figure 3—source data 1. Estimation of cell cycle duration and growth rate from bulk measurements of fixed cell populations. 10.7554/eLife.26947.023 Figure 3—source data 2. Measurements of single-cell dynamics of cell size captured by live-cell imaging.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Inhibition, Time-lapse Microscopy, Cell Cycle Assay, Generated, Cell Tracking Assay, Control, Single Cell Tracking, Live Cell Imaging

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Cells were treated with indicated inhibitors for 24 hr before collecting lysates. Anisomycin was added to select wells 1 hr prior to making lysates, to activate MAPK pathways. All inhibitors were used at the ‘high dose’ indicated in and . ( A ) Cells treated with p38 inhibitors display a lower level of p-HSP27 (downstream of p38). The p38 inhibitors induce a higher level of p-p38. This is due to negative feedback in the p-p38 pathway, and the fact that p38 inhibitors prevent p-p38 from phosphorylating downstream substrates, but do not block phosphorylation of p38 itself by upstream regulators. ( B, C ) Cells treated with JNK or MEK I/II inhibitor inactivate the corresponding pathway under Anisomycin induction. The influence of the inhibitor is not obvious under control condition probably due to low basal activation of the pathways.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Blocking Assay, Phospho-proteomics, Control, Activation Assay

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Measurements collected in the same experiment as . ( A ) Scatterplot comparing cells of negative control (DMSO) with cells under p38 inhibition (treated with indicated inhibitor and concentration). Each data point was measured from a cell population with a minimum of 7000 cells. The rapamycin concentration range is as follows: 0, 0.03, 0.1, 0.3, 3 and 30 nM. The results are representative of three independent experiments. ( B ) The slope between size and proportion of cells in G1 is either disturbed or weakened. p-Values were calculated with one-tailed Student t -test (H 0 : slope of control >= slope of compound treatment). The meta data and source code used for the analysis and visualization of the results is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Negative Control, Inhibition, Concentration Assay, One-tailed Test, Control

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: The p38 inhibitors and three higher concentrations shown here are also included in and . ( A ) Cells treated with only rapamycin concentration series (blue) display negative correlation between cell size and proportion of cells in G1. However, the negative correlation between cell size and proportion of cells in G1 disappears or weakens when cells are co-treated with p38 inhibitors and the rapamycin concentration series (red). The blue and red lines show the result of linear regression. The rapamycin concentration range is as follows: 0, 0.03, 0.1, 0.3, 3 and 30 nM. ( B ) The fitted slope of measurements shown in ( A ) For each compound treatment, its fitted slope is compared with the slope of the control (DMSO) from the same experiment. Significance was calculated with one-tailed Student t -test (H 0 : slope drug <= slope control ). The meta data and source code used for the analysis and visualization of the results is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Concentration Assay, Control, One-tailed Test

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A–C ) Scatterplots displaying relationship between nuclear size at birth with cell cycle duration for individual cells in DMSO control, p38 inhibition and mTOR inhibition. The points with error bar shows mean and SEM by binning cells with similar size. The dashed line shows the result of linear regression with the binned data. Measurements were obtained from time-lapse experiments as indicated in . (D) Bar plot comparing the slopes of the linear regression between size and G1 duration as shown in panel A–C. Error bar indicates 95% confidence bounds. The meta data and source code used to in this analysis is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control, Inhibition

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Cells were transfected with siRNA as indicated and subsequently assayed with a rapamycin concentration series (0, 0.03, 0.1, 0.3, 3 and 30 nM) as described in to assay the correlation of size and G1 length. Larger circle size indicates higher concentrations of rapamycin. ( A ) Knocking down p38α/βpartially weakens the negative correlation between cell size and proportion of cells in G1, while knockdown of p38γ/δ drastically disturbs the correlation. ( C ) The negative correlation between cell size and proportion of cells in G1 is disturbed when cells are transfected with siRNA against MKK3/4/6 but not MKK7. Each data point in is measured on an unsynchronized population with a minimum of 3000 cells. The results shown in are representative of two and three independent experiments with duplicates or triplicates. ( B, D ) Fitted slopes of the trends shown in . Error bars indicate 90% confidence intervals. Analysis is performed with the same method as indicated in . The meta data and source code to analyze and visualize the genetic knock down results is presented in . 10.7554/eLife.26947.027 Figure 4—source data 1. Binding activity (Kd’s in nM) of the p38 inhibitors used in the study against each of the p38 isoforms. Kd values in the table were extracted from ). As marked in that paper, blank fields indicate combinations that were tested, but for which binding was weak (Kd >10 μM), or not detected in a 10 μM primary screen. 10.7554/eLife.26947.028 Figure 4—source data 2. Measurements of cell size and cell cycle stage from the knockdown experiments as shown in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Transfection, Concentration Assay, Knockdown, Binding Assay, Activity Assay

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Western-blot of cell lysates from conditions shown in confirms efficiency of knockdown of MKKs ( A ) or p38 isoforms ( B ).

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Western Blot, Knockdown

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: The bar plot and error bar display mean and SEM across three replicate Western-blot experiments. Treatment of rapamycin or Torin-2 increases both p-p38 and p-CREB, confirming that activity in the p38 pathway is upregulated under mTORC1 inhibition. SB203580, a p38 inhibitor, significantly reduces the phosphorylation of CREB (downstream of p38), confirming that p38 activity is inhibited. p27 is a negative regulator of G1 progression. mTOR inhibition by rapamycin or Torin-2 upregulates p27 activity, which promotes a longer G1. Strikingly, cells co-treated with p38 inhibitor and mTOR inhibitor have lower p27 compared to treatment of p38 inhibitor alone. This may be the mechanism by which p38 inhibition disturbs the cells’ ability to compensate their small size with longer G1.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Western Blot, Activity Assay, Inhibition, Phospho-proteomics

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) Cells were treated with either 50 nM of Torin-2 or DMSO (control) for 20 hr, followed by drug wash-out and media replacement. Cells undergoing mTOR inhibition, on average, decrease in size and slow their proliferation rate. Following release from mTOR inhibition, cells grow but maintain a low proliferation rate until their normal size is reached. Cells resume a wild type rate of proliferation only when their size reaches the size of the untreated population. ( B ) Western blots of whole cell lysates collected at time points ranging from 0 to 20 hr post release from mTOR inhibition. Levels of mTOR pathway activity recover within 1 hr after Torin-2 wash-out. By contrast, activity of p38 remains upregulated in the Torin-treated cells compared with controls, and gradually fades away only as cells recover their wild-type size. ( C ) Cells simultaneously expressing reporters of both p38 MAPK and JNK were treated with a series of rapamycin concentrations, as in . Each data point (circle) corresponds to the average G1 cell size and the average level of MAPK activity (JNK and p38) that corresponds to a given concentration of rapamycin. As positive controls, we include populations that were co-treated with the p38 inhibitor, SB203580 (orange circles). Higher concentrations of rapamycin (bigger circle size) result in smaller cells with higher activity of p38 (top left panel). Unlike p38, activity of JNK was not upregulated in proportion to cell size (left bottom panel). Also shown are the correlations of MAPK activity (JNK and p38) and cell size at 6 hr post release from mTOR inhibition (right panels) (also see ). Each data point represents average values of cell size and MAPK activity of the G1 cells subpopulation from an unsynchronized population with a minimum of 3000 cells. Results shown here are representative of three independent experiments. The meta data and source code used to analyze and visualize the correlation between cell size and KTR readout is presented in . ( D ) Western-blots of whole cell lysates from samples collected at 0 or 6 hr post release from a 22 hr treatment with either 50 nM Torin-2, 1 μM cycloheximide or DMSO (control). ( E ) Western-blots of whole cell lysates from samples collected at 0 or 6 hr post release from a 30-min treatment with either 25 ng/mL anisomycin, hyperosmotic shocks (NaCl and Sucrose) or DMSO (control). 10.7554/eLife.26947.035 Figure 5—source data 1. Measurements of cell size and p38 KTR as shown in and .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control, Inhibition, Western Blot, Activity Assay, Expressing, Concentration Assay

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: The p38 KTR functions by translocating to the cytoplasm once p38 is activated. Cells were imaged after a 1 day treatment with DMSO (control), 3 nM rapamycin or 5 μM SB203580 (p38 inhibitor), or a 30 min treatment with 25 ng/mL Anisomycin (a stimulator of the p38 pathway). Anisomycin treatment results in reduced fluorescence in the nucleus, and a less defined nuclear boundary as compared to control. By contrast, treatment with SB203580 results in elevated fluorescence in the nucleus, implying a lower p38 activity. Cells subject to rapamycin treatment are smaller in size as compared to control. While these cells display a spectrum of cytoplasmic-to-nuclear localization, rapamycin treatment increases the fraction of cells that display p38 activity, as indicated by the blurry nuclear boundary and increased cytoplasmic localization of the KTR (highlighted by arrows).

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control, Fluorescence, Activity Assay

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Cells treated with either DMSO (control), 30 nM rapamycin or 1 μM cycloheximide for 1 day, or with 25 ng/mL Anisomycin (a stimulator of the p38 pathway) for 30 min were fixed and imaged. While Anisomycin treatment leads to hyperactivation of the p38 pathway, rapamycin or cycloheximide treatment result in a weak but visible elevation in p-p38 level in the nucleus (also see ).

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Control

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: Measurements were obtained from the same experiment as indicated in . Cells express dual reporters of both p38 MAPK and JNK were treated with a concentration series of rapamycin, decreasing cell size to varying extents. For each condition/replicate, cells were partitioned into G1, S and G2 stage according to the cellular DNA readout (see Materials and methods – Cell cycle stages). The activity of p38 MAPK negatively correlates with cell size after mTOR inhibition for cells that are in G1. Cells that are in S and G2 also display a negative correlation, but with a lower correlation coefficient. Interestingly, after cells are released from mTOR inhibition, p38 activity negatively correlates with cell size only among cells that are in G1, but not S or G2. This result supports the hypothesis that cell-size-dependent regulation of p38 activity is exclusive to the G1 phase of cell cycle, which is consistent with its assumed role in regulating G1 duration. The meta data and source code used to analyze and visualize the correlation between cell size and KTR readout among different cell cycle stages is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Concentration Assay, Activity Assay, Inhibition

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) Workflow of the experiment. Cells were treated with 50 nM Torin-2 with or without the indicated MAPK inhibitors for 22 hr, and then released from Torin-2 while still being subject to the indicated MAPK inhibitors (red) or DMSO (blue). MAPK inhibitors were administrated at a concentration consistent with the highest corresponding concentration used in and . At 0, 6, 24, 30 and 48 hr post release from Torin-2 treatment, samples were measured for both average cell size (B) and cell count (C). ( B ) Cells treated with DMSO (control) recovered in size within 24 hr and remained at a constant average size thereafter. Cells treated with p38 inhibitors, but not ERK or JNK inhibitors, failed to recover their size, even 48 hr post Torin-2 wash-out. This suggests that p38 inhibitors suppressed the recovery in cell size rather than slowing the kinetics associated with this process. ( C ) Cells treated with inhibitors of p38, but not inhibitors of ERK or JNK, show increased rates of proliferation as compared to control conditions, after being released from mTOR inhibition. Results shown in this figure are representative of two replicate experiments. The measurements and source code for visualization of the results is presented in . 10.7554/eLife.26947.038 Figure 6—source data 1. Cell size dynamics after released from mTOR inhibition.

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Concentration Assay, Cell Counting, Control, Inhibition

Journal: eLife

Article Title: Size uniformity of animal cells is actively maintained by a p38 MAPK-dependent regulation of G1-length

doi: 10.7554/eLife.26947

Figure Lengend Snippet: ( A ) Workflow of the experiment. Similarly as indicated in , Cells were co-treated with both Torin-2 (50 nM) with or without the indicated MAPK inhibitor for 22 hr. The cells were then released from both inhibitors and grown in regular medium. At 0, 6, 24, 30, and 48 hr post release from the inhibitors, the cells were measured for both cell size ( B ) and cell number ( C ) by Coulter counter. ( B ) Cells in ‘DMSO’ condition recovered in size within 24 hr and stays at this size. Cells with a history of p38 inhibition, but not Erk or JNK inhibition, displayed a delayed size-recovery dynamics. ( C ) Cell proliferation were followed after release from the inhibitors. The results shown in this figure are representative of two replicate experiments. The measurements and source code used to visualize the results shown in this figure is presented in .

Article Snippet: Lentiviral expression vectors encoding the JNK and p38 MAPK Kinase Translocation Reporters (KTR) were a kind gift from Markus Covert (Addgene plasmids No. 59151 and 59155).

Techniques: Inhibition

Journal: Nature Communications

Article Title: Activation of IRF3 in cardiomyocytes impairs mitochondrial oxidative function through PGC-1α inhibition and drives heart failure

doi: 10.1038/s41467-026-69792-4

Figure Lengend Snippet: a Immunoblot showing expression of p-IRF3 and IRF3 levels in the left ventricle tissue of humans with ischemic cardiomyopathy (ICM) compared to non-failing (NF) hearts, NF ( n = 6) and ICM ( n = 6), biological replicates. Vinculin was used as a loading control. b Quantification of the immunoblot shown in Fig. 1a. Statistical significance was calculated by unpaired two-tailed Student’s t test, NF ( n = 6) and ICM ( n = 6), *** P = 5.1 × 10 -7 . c mRNA expression of IRF3 and target genes in the left ventricle tissue of human patients with ICM compared to NF hearts determined by qPCR. Statistical significance was calculated by unpaired two-tailed Student’s t test, samples from NF ( n = 7) and ICM patients ( n = 10) are biological replicates, IRF3 : ** P = 0 0.0230; IFIT2 : * P = 0.0534. d UMAP showing single-cell analysis of genes regulated in the left ventricle tissue of patients with heart failure compared to healthy control hearts. e Gene expression of IRF3 in cardiomyocytes isolated from patients with heart failure. f Immunoblot showing expression of p-IRF3 and IRF3 levels in the left ventricle tissue of mice with LAD induced myocardial infarction (MI) compared to Sham operated αMHC Cre control. Vinculin was used as a loading control. N = 3 per group, biological replicates. g Box plot showing gene expression of Irf3 and target genes regulating type I IFN signaling in the left ventricle tissue of mice with LAD induced MI determined by qPCR. Sham ( n = 7) and LAD ( n = 8), biological replicates. Box and whiskers plot showing all minimum to maximum points. Significance was calculated by unpaired two-tailed Student’s t test, Irf3 : ** P = 0.0047; Ifnβ : ** P = 0.0041; Ifit1 : ** P = 0.0022; Ifit2 : ** P = 0.0099; Ifit3 : ** P = 0.0046; Rsad2 : * P = 0.0438; Ccl2: * P = 0.0311. h Immunoblot showing expression of OXPHOS proteins [NADH: ubiquinone oxidoreductase (NDUFB8), Succinate dehydrogenase (SDHB), Cytochrome c oxidase I (CoI), Ubiquinol Cytochrome c oxidoreductase (UQCRC2), ATP synthase (ATP5A)] in the left ventricle tissue of humans with ICM compared to NF hearts, n = 6 per group, biological replicates. i Quantification of the immunoblot shown in Fig. 1h. Statistical significance was calculated by unpaired two-tailed Student’s t test, n = 6 per group, biological replicates, NDUFB8: *** P = 0.0005; SDHB: * P = 0.0269; UQCRC2: * P = 0.0162; COI: ** P = 0.0024; ATP5A: ** P = 0.0015. j Gene expression of mitochondrial OXPHOS marker genes by qPCR in the left ventricle tissue of mice with LAD induced MI. Box and whiskers plot showing all minimum to maximum points. Sham ( n = 7) and LAD ( n = 8), biological replicates. Significance was calculated by unpaired two-tailed Student’s t test and P values are shown in the box plot. k Nd1 , 16sRNA (mitochondrial) and Sdhb (nuclear) levels in mtDNA isolated from rat left ventricle was quantified by qPCR. Data points represent mtDNA samples ( n = 4), biological replicates. l Immunoblot showing pIRF3 levels in primary cardiomyocytes treated with 1 µg/ml of freshly isolated mtDNA for 6 h. N = 3 independent replicates per group. Data in all panels are represented as mean ± SEM. Source data are provided as a Source file.

Article Snippet: The concentration of TNF-α (#DY410), CCL2 (#DY479), IL-1β (#DY401), and IL-6 (#DY406) was measured in the mouse plasma samples using the equivalent DuoSet ELISA kits (R&D Systems, Minneapolis, MN, USA) following the manufacturer’s protocols.

Techniques: Western Blot, Expressing, Control, Two Tailed Test, Single-cell Analysis, Gene Expression, Isolation, Marker

Journal: Nature Communications

Article Title: Activation of IRF3 in cardiomyocytes impairs mitochondrial oxidative function through PGC-1α inhibition and drives heart failure

doi: 10.1038/s41467-026-69792-4

Figure Lengend Snippet: a Representative model showing strategy of CMI3OE transgenic mouse generation. Irf3-2D fl/fl mice were bred with αMHCMerCreMer (αMHCMCM) mice to generate tamoxifen inducible cardiomyocyte-specific CMI3OE ( Irf3-2D fl/αMHCMCM) mice. b Schematic representation of cardiomyocyte-specific expression of murine IRF3-2D by oral gavage of low dose tamoxifen (30 mg/kg) to induce MerCreMer-mediated excision of cardiomyocyte-specific floxed cassette in 12wk old male mice. c Gross morphology of αMHCMCM (Cre) and CMI3OE male mice at 12wks of age. d Kaplan-Meier curve showing survival of CMI3OE compared to αMHCMCM (Cre) mice. e Western blot showing protein levels of IRF3 in the cardiac ventricular tissue, n = 3 per group, biological replicates. f Quantification of the Western blot shown in Fig. 3e, n = 3 per group, biological replicates. Data analyzed by unpaired two-tailed Student’s t test ***P = 2 × 10 -5 . g mRNA expression of Irf3 and its target genes in the cardiac ventricular tissue determined by qPCR, n = 7 per group, biological replicates. Data analyzed by unpaired two-tailed Student’s t test, Irf3 : *** P = 1.8 × 10 -8 ; Ifnβ : * P < 0.0280; Ifit1 : *** P < 1.5 × 10 -9 ; Ifit2 : *** P < 0.0005; Ifit3 : *** P < 0.0002; Rsad2 : *** P < 9.9 × 10 -7 ; Ccl2 : ** P < 0.0030. h-j Plasma cytokine levels in CMI3OE mice determined by ELISA. Samples used are biological replicates. Data analyzed by unpaired two-tailed Student’s t test, CCL2: * P = 0.0430 [ n = 5 per group]; TNFα: * P = 0.0229 [ n = 5 per group]; IL-6: * P = 0.0532 [ n = 6 (Cre), n = 9 (CMI3OE)]. k Body weight measured in αMHCMCM (Cre) and CMI3OE mice, n = 5 per group. l Representative echocardiography images from αMHCMCM (Cre) and CMI3OE mice. m – q Cardiac function in αMHCMCM (Cre) and CMI3OE mice determined by echocardiography, n = 5 per group, biological replicates. Data analyzed by unpaired two-tailed Student’s t test, %EF: *** P = 2.3 × 10 -5 ; %FS: *** P = 5.8 × 10 -5 ; LVPWd: * P = 0.0448; LVmass/BW: * P = 0.0533. Cardiac function was measured in three independent cohorts with similar results. r Heart weight to tibia length determined in αMHCMCM (Cre) and CMI3OE mice, n = 5 per group, data analyzed by unpaired two-tailed Student’s t test, * P = 0.0399. s Lung weight to tibia length determined in αMHCMCM (Cre) and CMI3OE mice, n = 5 per group. Survival curve, gene expression analysis, and echocardiography experiments were performed using independent cohorts. Data in all panels are represented as mean ± SEM. Source data are provided as a Source data file.

Article Snippet: The concentration of TNF-α (#DY410), CCL2 (#DY479), IL-1β (#DY401), and IL-6 (#DY406) was measured in the mouse plasma samples using the equivalent DuoSet ELISA kits (R&D Systems, Minneapolis, MN, USA) following the manufacturer’s protocols.

Techniques: Transgenic Assay, Expressing, Western Blot, Two Tailed Test, Clinical Proteomics, Enzyme-linked Immunosorbent Assay, Gene Expression

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Identification of regenerating factor as a regulator of therapeutic genes for Parkinson's disease therapy. A) Conceptual diagram outlining the basis of an epigenetic regulator. B) Comparative gene expression heatmap of substantia nigra (SN) in wild type control versus 6‐OHDA‐induced Parkinson's disease (PD) mouse model. C) Heatmap showing gene expression profiles in the caudate and putamen regions of healthy individuals (HI) and a cohort of human PD patients. BG: Basal Ganglia. D) Immunofluorescence images showing TUJ1‐ and MAP2‐positive cells under each condition. Scale bar = 50 µm. E) Immunochemistry and Sholl analysis of TH‐labeled neurons. Left panel: morphology of individual neurons. Right panel: Sholl analysis showing the number of neurite intersections as a function of distance from the soma. Scale bar = 100 µm. The data are presented as mean ± SEM ( n = 5 – 6 cells per group). F) Representative traces of action potentials evoked by depolarizing current injections under each condition (sham, 6‐OHDA, 6‐OHDA+NDST3). G) Dot plot showing the top 14 GO Biological Process terms from enrichment analyses: 6‐OHDA versus Sham (left side) and 6‐OHDA+NDST3 versus 6‐OHDA (right side). H) Pearson correlation matrix of transcriptomic among samples.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Gene Expression, Control, Immunofluorescence, Labeling

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Therapeutic efficacy of NDST3 and retrograde tracing with CTB in mice. A) Schematic diagram of in vivo experimental design involving CTB injection in the PD mouse model. B) Representative immunofluorescence images of CTB, TH, and NDST3 expression in the SN of Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). C) Quantification of CTB‐, TH‐, and NDST3‐positive cells shown in Figure . Data are presented as mean ± SEM ( n = 6 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. ** p < 0.01, *** p < 0.001, **** p < 0.0001, and ns = not significant. D) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). E) 3D Z‐stack analysis (IMARIS) of TH‐positive neurons obtained via confocal microscopy. F) DAB‐DAT staining in the SN.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Drug discovery, Retrograde Tracing, In Vivo, Injection, Immunofluorescence, Expressing, Confocal Microscopy, Staining

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Efficacy and electrophysiological properties of NDST3 in chemical‐induced PD model. A) Representative traces of spontaneous firing currents recorded from DA neurons of the SNpc in brain slices from each group. B) Cumulative fractions curves showing shortened inter‐event intervals, indicating a higher frequency of spontaneous firing in the 6‐OHDA + NDST3 group compared to the 6‐OHDA group. The inner bar graph showed mean inter‐event intervals in the ipsilateral of SNpc of each group. Data are presented as mean ± SEM ( n = 6 – 8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001. C) Quantification of DA neuronal firing rates in the ipsilateral SNpc of each group. The data are presented as mean ± SEM ( n = 6–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, and ** p < 0.01. D) Representative in vivo recording traces from the SNpc of live animals in each condition. E) Instantaneous firing frequencies during the recorded period. ( n = 4–6 independent animals per group; repeated measures) Two‐way ANOVA with Tukey's multiple comparisons test, * p < 0.05. F) Comparison of action potential waveforms among DA neurons across conditions. G) Representative image of DAB‐TH staining in ST and SN. Scale bar = 1 mm. H) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, MPTP‐induced PD mice, NDST3‐treated PD mice, and NDST3 only‐treated mice. Scale bar = 50 µm and 10 µm (Magnified image). I) Error count during the challenging beam traversal test for each experimental condition. The data are presented as mean ± SEM. ( n = 7 – 8 independent animals per group) Two‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. J) Errors per step during the challenging beam traversal test across conditions. The data are presented as mean ± SEM ( n = 7 – 8 independent animal per group). One‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. K) Fall latency in the wire‐hanging test. The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001 and **** p < 0.0001. L) Time to orient downward (T‐turn) and M) time to descend to the base (T‐total). The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, *** p < 0.001 and **** p < 0.0001.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: In Vivo, Comparison, Staining, Immunofluorescence

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Molecular mechanisms of NDST3 in the PD model. A) One‐way hierarchical clustering heatmap based on Z‐score of normalized expression value for 5629 genes selected with fold change ≥ 2 and raw p ‐value < 0.05. B) Principal component analysis (PCA) analysis of RNA‐seq data to visualize sample‐to‐sample variation. C) Volcano plot showing differentially expressed genes between 6‐OHDA and Sham group; Down‐regulated genes marked in blue. D) Volcano plot showing differentially expressed genes between 6‐OHDA+NDST3 and 6‐OHDA; Up‐regulated genes marked in red. E) Dot plot of top 14 GO cellular component terms from GO enrichment analyses: 6‐OHDA+NDST3 versus 6‐OHDA. Heatmap showing gene expression patterns in F) pre‐synaptic neurons, G) post‐synaptic neurons, and H) glia compartments. I) UMAP visualizing cluster identity. J) UMAP representation comparing cellular composition in 6‐OHDA and 6‐OHDA+NDST3. K) Branched trajectory analysis illustrating cell state transitions in a 2D state‐space, where each dot represents a single cell, color‐coded by group identity.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Expressing, RNA Sequencing, Gene Expression, Single Cell

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Comprehensive analysis of spatial transcriptomics and epigenetic modulation following NDST3 treatment in a PD model. A) Heatmap showing gene expression patterns in each cluster. ** p < 0.01, and **** p < 0.0001. B) Gene concept network plot displaying genes enriched in catabolic, metabolic, and wound healing GO categories. The top 30 most differentially expressed genes comparing 6‐OHDA versus Sham and 6‐OHDA+NDST3 versus 6‐OHDA. Node color intensity represents the log2 fold‐change of gene expression. C) Cell‐cell communication network plot illustrating interactions among three distinct cell clusters in 6‐OHDA‐induced PD model (left panel) and NDST3‐treated PD model (right panel), based on ligand–receptor pair probabilities using the CellChat database. Line thickness indicates proportionality to the number of interactions. D) Spatial localization of dopamine‐related markers. E) Spatial mapping of dopaminergic lineage markers identified via scRNA‐Seq. F) Heatmap visualization of CUT&RUN and ATAC‐Seq signal intensity ±2 kb around the TSS. G) Immunofluorescence images showing H3K27ac and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm. H) Venn diagram illustrating overlapping genes among DEGs from RNA‐Seq, scRNA‐Seq Cluster 9, CUT&RUN peak, and ATAC‐Seq peak. Average signal plot of I) CUT&RUN and J) ATAC‐seq signals at over‐enriched TSS regions of the Ncoa7 gene. K) Structure of NDST3‐NCOA7‐H3K27ac complex. Blue – NDST3, Green – NCOA7, and Red – H3K27ac. The yellow boundary represents the interaction region.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Spatial Transcriptomics, Gene Expression, Immunofluorescence, RNA Sequencing

Journal: Chemotherapy Research and Practice

Article Title: Inhibition of NF- κ B by Dehydroxymethylepoxyquinomicin Suppresses Invasion and Synergistically Potentiates Temozolomide and γ -Radiation Cytotoxicity in Glioblastoma Cells

doi: 10.1155/2013/593020

Figure Lengend Snippet: (a) The analysis of the methylation status of the MGMT gene in GBM cell lines revealed two groups: methylated (U87MG, U343MG-a, and LN319) and hemimethylated (U251, T98G and U138MG); however, only T98G and U138MG express this gene as detected by real time quantitative PCR (*a pool of 5 white matter samples was used as calibrator); (b) treatment with DHMEQ efficiently decreases the expression of MGMT after 24 h. Data represents two independent experiments in duplicate and are expressed as mean ± SEM; (c) comet assay showed that TMZ-induced DNA damage significantly increases in T98G and U138MG cells as a probable consequence of reduced MGMT expression after exposure to DHMEQ. Each value represents the mean derived from at least three individual experiments (mean ± SD).

Article Snippet: Real-time RT-PCR reactions were performed in triplicate in 10 μ L reactions using the inventoried TaqMan probes (Applied Biosystems, Foster City, CA, EUA) for BCL2 (Hs00608023_m1), BCL-XL (Hs00236329_m1), XIAP (Hs01597783_m1), MMP-2 (Hs01548727_m1), MMP-14 (Hs00237119_m1), uPA (Hs01547054_m1), TIMP-2 (Hs00234278_m1), and MGMT (Hs01037698_m1), on the ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA, EUA).

Techniques: Methylation, Real-time Polymerase Chain Reaction, Expressing, Single Cell Gel Electrophoresis, Derivative Assay

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a Downregulation of SELENOW during osteoclastogenesis. Osteoclast precursors were cultured with RANKL and M-CSF, and SELENOW gene expression was analysed by RT-PCR, northern blotting (NB), and immunoblotting (IB). b , c RANKL/RANK/TRAF6 axis-dependent downregulation of SELENOW . Osteoclast precursors were pretreated with interferon-γ (IFN-γ; 150 U/ml), which degrades TRAF6, 30 min prior to RANKL stimulation. Osteoclast precursors treated with IFN-γ ( b ) and TRAF6-deficient osteoclast precursors ( c ) failed to induce RANKL-mediated SELENOW downregulation. d Up- and downregulation of SELENOW via ERK and p38 activation, respectively. Osteoclast precursors were pretreated with inhibitors of ERK (PD98059), JNK (SP600125), p38 (SB203580), NF-κB (SN50), and NFATc1 (cyclosporin A, CsA) for 30 min in the presence of M-CSF and then stimulated with RANKL for 2 days. The expression levels of SELENOW were analysed using RT-PCR. e , f Decreased and increased osteoclast formation following SELENOW knockdown ( e ) and overexpression ( f ), respectively. Osteoclast precursors infected with shRNA-mediated SELENOW gene-silencing lentivirus and SELENOW -overexpressing retrovirus were differentiated into osteoclasts and TRAP-positive multi-nucleated cells (TRAP + MNCs) with more than 3 nuclei were assessed ( n = 3). Scale bars, 100 μm. Images are representative of three independent experiments. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( f ). One-way ANOVA was performed followed by Turkey’s test ( e ). Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Cell Culture, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Northern Blot, Western Blot, Activation Assay, Expressing, Knockdown, Over Expression, Infection, shRNA, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched SELENOW −/− mice at 10 weeks. BV/TV, trabecular bone volume per tissue volume; Tb.N, trabecular bone number; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; BMD, bone mineral density. Scale bar, 0.5 mm. b , c Reduced osteoclast formation on the trabecular bone surface of SELENOW −/− mice. H&E- and TRAP-stained sections of tibiae were used to detect osteoblasts ( b ) and osteoclasts ( c ), respectively. NOb/BS, number of osteoblasts per bone surface; NOc/BS, BV/TV, trabecular bone volume per tissue volume; number of osteoclasts per bone surface. In addition, osteoclast size and eroded bone surface were analysed from the TRAP-stained sections. Scale bar, 100 μm. d Increased bone mass phenotype in μCT analysis of proximal tibiae from WT male littermates ( SELENOW tm1c/tm1c ; SeW fl/fl ) and age/sex-matched osteoclast-specific SELENOW knockout mice ( SELENOW tm/c/tm1c :LysM-Cre; SeW fl/fl ;LysM-Cre) at 10 weeks. Scale bar, 0.5 mm. e Analysis of NOb/BS, number of osteoblasts per bone surface, and BV/TV in H&E-stained sections. Scale bar, 100 μm. f Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections. Scale bar, 100 μm. g Histomorphometric analysis of the tibia. BFR, bone formation rate. Scale bar, 10 μm. Data represent mean ± SD ( n = 7 mice per group in a – c ; n = 8 mice per group in d – g ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Staining, Knock-Out, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a μCT analysis of proximal tibiae from wild-type (WT) male littermates and age/sex-matched transgenic (TG) mice at 10 weeks. Scale bar, 0.5 mm. b μCT images of calvaria and analysis of bone parameters [trabecular bone volume per tissue volume (BV/TV) and BMD]. scale bar, 3 mm. c , d Increased osteoclast formation on the trabecular bone surface of TG mice. Analysis of NOb/BS, number of osteoblasts per bone surface, from H&E-stained sections ( c ). Analysis of NOc/BS, number of osteoclasts per bone surface, osteoclast size and eroded bone surface from TRAP-stained sections ( d ). Scale bar, 100 μm. e – g Whole calvaria ( e ) and cross-sections ( f ) were stained with TRAP. The number of TRAP + osteoclasts and the calvarial marrow cavity area ( g ), which reflects the degree of osteoporosis, were measured in whole sections. Scale bar, 1 mm. h The level of urinary DPD, a marker of osteoporosis, was measured by enzyme immunoassay. Data represent mean ± SD ( n = 12 mice per group in a , c , d and f , and n = 7 mice per group in b and e – h ). Statistical significance was determined by Student’s two-tailed t -test. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Transgenic Assay, Staining, Marker, Enzyme-linked Immunosorbent Assay, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a Osteoclastogenic transcription factors and SELENOW co-translocate into the nucleus. Osteoclast precursors infected with SELENOW -harbouring retrovirus were cultured with M-CSF and RANKL for 2 days. After cells were exposing to RANKL-free condition for 3 h and treated without or with an inhibitor of NFATc1 (cyclosporin A, CsA), cells were stimulated with RANKL for 20 min. Cytosolic and nuclear proteins were fractionated and NF-κB, NFATc1, and SELENOW levels were determined by immunoblotting. b Luciferase reporter assay. RAW264.7 cells were transfected with AP-1-, NF-κB-, and NFATc1-luciferase reporter or pcDNA3.1-His-tagged SELENOW (SeCys-13) vector. Cells were stimulated with RANKL for 24 h and luciferase activity was measured ( n = 3). c , d SELENOW interacts with NF-κB and NFATc1. Cytosolic extracts from HEK 293 T cells expressing a His-tagged SELENOW (SeCys-13) were pulled down with an anti-His-Tag antibody ( c ). Also, cytosolic extracts from HEK 293T cells with a His-tagged wild-type SELENOW (SeCys-13) and His-tagged SELENOW mutants in which SeCys-13 was replaced by cysteine (SeCys13C) or serine (SeCys13S) were immunoprecipitated (IP) with anti-His-Tag antibody and then immunoblotted (IB) with the indicated antibodies ( d ). e ChIP assay. Osteoclast precursors were cultured with M-CSF alone (d0) or with M-CSF and RANKL for 3 days (d3; left panels). Also, osteoclast precursors from wild-type (WT) and SELENOW -overexpressing transgenic (TG) mice were cultured with M-CSF and RANKL for 3 days (right panels). Following immunoprecipitation (IP) of chromatin with anti-SELENOW antibody, ChIP assay was performed to detect the promoter for NF-κB- or NFATc1-binding sites. f , g 14-3-3γ mediates nuclear translocation of NFATc1, NF-κB, and SELENOW, and osteoclast differentiation. After osteoclast precursors from WT and TG mice were cultured with M-CSF and RANKL for 2 days to induce pre-osteoclasts, the cells were exposed to M-CSF- and RANKL-free condition for 3 h and were stimulated with RANKL for indicated times ( f ; left panel). In addition, this was performed in TG mice-derived pre-osteoclasts transduced with control lentivirus (pLKO) or 14-3-3γ-targeted shRNA-harbouring lentivirus ( f ; right panel). Nuclear proteins were fractionated and subjected to immunoblotting. Osteoclast precursors from TG mice were infected with shRNA-mediated 14-3-3γ gene-silencing lentivirus and differentiated into osteoclasts ( n = 3). TRAP + MNCs with more than 3 or 10 nuclei were assessed ( g ). Scale bar, 100 μm. Data represent the mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( g ). One-way ANOVA was performed followed by Turkey’s test ( b ). Images are representative of three independent experiments. Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Infection, Cell Culture, Western Blot, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Activity Assay, Expressing, Immunoprecipitation, Transgenic Assay, Binding Assay, Translocation Assay, Derivative Assay, Transduction, Control, shRNA, Two Tailed Test

Journal: Nature Communications

Article Title: Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts

doi: 10.1038/s41467-021-22565-7

Figure Lengend Snippet: a , b Induction of pre-osteoclast fusion and osteoclastic bone resorption by SELENOW. Fusion assay in pre-osteoclasts from wild-type and SELENOW -overexpressing transgenic mice ( a ) or SELENOW −/− mice ( b ). Osteoclast precursors were treated with M-CSF and RANKL for 2 days to form pre-osteoclasts following fusion assay. Osteoclast fusion rate was determined by counting TRAP + MNCs with a diameter ≥100 μm ( n = 3). c , d Pit formation. Osteoclast precursors prepared from wild-type and SELENOW -overexpressing transgenic mice ( c ) or SELENOW −/− mice ( d ) were differentiated into osteoclasts for 4 days. After mature osteoclasts were detached from the culture dish and seeded on dentine slice, cells were further cultured with M-CSF and RANKL for 2 days to allow bone resorption. Pit formation by osteoclasts is expressed as a percentage of the resorbed area on the bone slice surface ( n = 3). e Anti-apoptotic effect of SELENOW. Mature osteoclasts were transduced with SELENOW -overexpressing retrovirus and cell survival was assessed 2 days later by staining with TRAP (upper panels) or FITC-labelled phalloidin (lower panels) to detect TRAP + osteoclasts with a full actin ring ( n = 3). f Caspase activity was assessed at indicated times after mature osteoclasts were cultured as in ( e , n = 3). g Increase in the cellular redox status by SELENOW. Osteoclasts were transduced with SELENOW -overexpressing retrovirus and total thiol content was assessed at indicated times ( n = 3). h Increase in the cellular redox status by NAC. After treatment with 4 mM NAC for 24 h or no treatment, cytosolic extracts of mature osteoclasts were prepared and assayed for free thiol level ( n = 3). i Increased mature osteoclast survival by NAC ( n = 3). Osteoclasts were treated as described in h and then stained as in e . Scale bars, 100 μm. Data represent mean ± SD of triplicate samples. Statistical significance was determined by Student’s two-tailed t -test ( a – e , i ). One-way ANOVA was performed followed by Turkey’s test ( f – h ). Source data are provided as a Source Data file.

Article Snippet: For qPCR analysis, total RNA was reverse transcribed into cDNA with the Superscript First-Strand Synthesis System (Invitrogen) and the reaction was carried out on a 7500 Detection System (Applied Biosystems, Foster City, CA, USA) using the Real-time TaqMan PCR assay kit that included primer sets for NFATc1 (Mm00479445_m1), Acp5 (Mm00475698_m1), and OSCAR (Mm00558665_m1) (Thermo Fisher Scientific).

Techniques: Single Vesicle Fusion Assay, Transgenic Assay, Cell Culture, Transduction, Staining, Activity Assay, Two Tailed Test

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

Techniques: Gene Expression

Journal: Scientific Reports

Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions

doi: 10.1038/s41598-022-18400-8

Figure Lengend Snippet: The differentiation potential of cells in culture can be altered by culture medium. ( A ) H9 cells cultured with Essential 8 (Es8) medium on vitronectin-N (VTN)–coated dishes were transferred to RFF2 medium, cultured for 15 days (3 days/passage × 5 passages), transferred again to Es8 medium, cultured 24 days (3 days/passage × 8 passages), and then transferred again to RFF2 medium. Photos of cells in designated culture conditions, with the cell number scored at day 3 after seeding 1.0 × 10 5 cells (left panels); flow cytometric analysis of CHD7, CHD7 copy numbers from 5 ng total RNA at day 3 (middle panels); and photographs of EBs formed by day 14 from cells in each culture condition and numbers of EBs formed (right panels). The results are representative of three independent experiments. ( B ) H9 cells were cultured either with Es8 or RFF2 on VTN-N–coated dishes. The loci of copy number variants (CNVs) detected when cells were cultured with Es8 medium (left panels) or RFF2 medium (right panels) are shown. CHD7 expression was determined by flow cytometry (mean values are shown), and CHD7 copy numbers were determined by digital droplet PCR in cells cultured with Es8 or RFF2 medium.

Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (Hs00215010_m1; Thermo Fisher).

Techniques: Cell Culture, Expressing, Flow Cytometry

Journal: Scientific Reports

Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions

doi: 10.1038/s41598-022-18400-8

Figure Lengend Snippet: Activation of mitochondrial function is coupled with differentiation. ( A ) Morphology, CellROX (ROX) immunostaining, CHD7 copy numbers, and mitochondrial membrane voltage (JC-1 assays) in cells cultured with Es8 medium on VTN-N–coated dishes (Es8/VTN) for 3 days (left panels) or with RFF2 medium on VTN-N–coated dishes (RFF2/VTN) for 3 days (right panels) are shown. Mitochondrial membrane voltage was assessed by subtracting baseline electrons (after depolarization) from total electrons (red circle). The percentage of each fraction in the scatter plot of JC-1 assays is shown. ( B ) H9 cells were cultured with Es8 or RFF2 medium, and culture medium was collected and replaced with fresh medium every day for 3 days. 2-Aminoadipic acid (2-AAA), malate, and citrate levels in culture medium were measured using LC–MS/MS. The measured values were standardized as the mean area ratio/cell/h for 3 days. The average values (n = 3) with error bars (SD) are shown in the bar graphs. The results of three independent experiments are shown. ( C ) Morphology, ROX staining, mitochondrial membrane voltage (JC-1 assays; red circle), and gene expression profiles (RT-qPCR score card panels) of H9 cells cultured with Es8 medium on VTN-N–coated dishes on day 5 (left panel: starting material for differentiation by Es6 medium) and Es6 medium on VTN-N–coated dishes on day 5 are shown (right panel). The interpretation of gene expression levels by RT-qPCR is shown in the attached table. The results of three independent experiments are shown.

Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (Hs00215010_m1; Thermo Fisher).

Techniques: Activation Assay, Immunostaining, Membrane, Cell Culture, Liquid Chromatography with Mass Spectroscopy, Staining, Gene Expression, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions

doi: 10.1038/s41598-022-18400-8

Figure Lengend Snippet: CHD7 expression affected the differentiation potential and growth of undifferentiated cells. ( A ) H9 cells cultured with Es8 on VTN-N–coated dishes (Es8/VTN, left panels) or with RFF2 on VTN-N–coated dishes (RFF2/VTN, right panels) were transfected with mock (control), mCHD7 , or siCHD7 . The morphology, CHD7 copy numbers, gene expression profiles (RT-qPCR), EB morphology, and EB numbers formed at day 14 under different culture conditions are shown. The representative results of three independent experiments are shown. ( B ) CHD7 expression in H9 cells determined by flow cytometry after cells were transferred from RFF2 to Es8 on VTN-N–coated dishes at passage 0 (P0), P5, and P7. Cells were cultured for 3 days between passages. ( C ) Fold increase of H9 cells after 48 h (upper panel) and CHD7 expression, as determined by RT-qPCR, after transfection of H9 cells with various doses of siCHD7 (lower panel). The average values (n = 3) with error bars (SD) are shown in the bar graphs. Representative data from three independent experiments are shown.

Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (Hs00215010_m1; Thermo Fisher).

Techniques: Expressing, Cell Culture, Transfection, Control, Gene Expression, Quantitative RT-PCR, Flow Cytometry

Journal: Scientific Reports

Article Title: Improving the differentiation potential of pluripotent stem cells by optimizing culture conditions

doi: 10.1038/s41598-022-18400-8

Figure Lengend Snippet: Recloning of cells with differentiation potential based on culture conditions. ( A ) iPSC clones (201B7, PFX#9, SHh#2, or 253G1 cells) or ESC clones (H9 cells) were cultured either on feeder cells or on L511- or L521-coated dishes with iPSC or mTeSR1 medium. Clones were then transferred to Es8 medium and cultured on VTN-N–coated dishes. The mean and convergence of CHD7 expression of cell clones was determined by flow cytometry before (gray histogram) and after (red histogram) changing culture conditions. Representative results from three independent experiments are shown. ( B ) Flow cytometric analysis of cell clones for the mean and coefficient of variation (CV) measured before (circle) and after (square) changing culture conditions are plotted on the left panel and the differentiation potential before and after changing the culture conditions was assessed by the number of EBs formed and is shown on the right panel. The data set shown in ( B ) was generated from the same samples shown in ( A ).

Article Snippet: Briefly, cDNA was synthesized from 5 ng total RNA extracted from cells cultured with hPSCs or Es8 medium using TaqMan Gene Expression Assays (Hs00215010_m1; Thermo Fisher).

Techniques: Clone Assay, Cell Culture, Expressing, Flow Cytometry, Generated

Journal: PloS one

Article Title: Wnt pathway activity in breast cancer sub-types and stem-like cells.

doi: 10.1371/journal.pone.0067811

Figure Lengend Snippet: Figure 3. Gene expression analysis of Wnt signalling in monolayer (Mono) and anoikis resistant (AR) cells of normal breast cell lines (N), ER-ve and ER+ve breast cancer cell lines. A) Protein expression of activated B-catenin (unphosphorylated), Lef1, Axin2, DKK1 and B-actin (housekeeper) in MCF7 monolayer and AR cells. B) Cluster analysis was performed using the fold change in expression

Article Snippet: MCF10a, MCF7, MDA-MB-231, primary human normal breast cells and primary human invasive breast cancer cells were plated into MS culture and treated with a single dose of human recombinant DKK1 (R and D systems) at increasing concentrations (0–100ng/ml).

Techniques: Gene Expression, Expressing

Journal: PloS one

Article Title: Wnt pathway activity in breast cancer sub-types and stem-like cells.

doi: 10.1371/journal.pone.0067811

Figure Lengend Snippet: Figure 4. Modulation of Wnt signalling in normal and breast cancer cell lines. Single cells were plated in non-adherent conditions and treated with increasing concentrations of either Wnt3a (0–50 ng/ml) or DKK1 (0–100 ng/ml) and cultured for 7 days and number of mammospheres counted. Wnt3a treatments are displayed in the left panel and DKK1 treatments in the right panel. Light grey bars represent untreated control A) MCF10a cells (Wnt3a) B) MCF7 cells (Wnt3a) C) MDA-MB-231 cells (Wnt3a) D) MCF10a cells (DKK1) E) MCF7 cells (DKK1) F) MDA-MB-231 cells (DKK1). Data is expressed as % mammosphere formation units. P values were generated by ANOVA. Asterisks mark individual comparisons which reached statistical significance * ,0.01 ** ,0.001 generated by a T-test. G) Image of a MCF10a mammosphere H) Image of an MCF7 mammosphere I) Image of an MDA-MB-231 mammosphere. Scale bar represents 50 mM. doi:10.1371/journal.pone.0067811.g004

Article Snippet: MCF10a, MCF7, MDA-MB-231, primary human normal breast cells and primary human invasive breast cancer cells were plated into MS culture and treated with a single dose of human recombinant DKK1 (R and D systems) at increasing concentrations (0–100ng/ml).

Techniques: Cell Culture, Control, Generated

Journal: PloS one

Article Title: Wnt pathway activity in breast cancer sub-types and stem-like cells.

doi: 10.1371/journal.pone.0067811

Figure Lengend Snippet: Figure 5. Modulation of Wnt signalling in normal and primary breast cancer samples (Normal n = 3; ER+ve n = 3; ER-ve n = 3). Single cells were plated in non-adherent conditions and treated with increasing concentrations of either Wnt3a (0–50 ng/ml) or DKK1 (0–100 ng/ml) and cultured for 7 days and number of mammospheres counted. Wnt3a treatments are displayed in the left panel and DKK1 treatments in the right panel. Light grey bars represent untreated control A) primary normal breast cells (Wnt3a) B) ER+ve primary breast cancer cells (Wnt3a) C) ER-ve primary breast cancer cells (Wnt3a) D) primary normal breast cells (DKK1) E) ER+ve primary breast cancer cells (DKK1) F) ER2ve primary breast cancer cells (DKK1). Data is expressed as % mammosphere formation units. P values were generated by ANOVA. Asterisks mark individual comparisons which reached statistical significance * .0.01 ** .0.001 generated by a T-test. G) Image of a normal primary mammosphere H) Image of an ER positive primary tumour mammosphere I) Image of an ER negative primary tumour mammosphere. Scale bar represents 50 mM. doi:10.1371/journal.pone.0067811.g005

Article Snippet: MCF10a, MCF7, MDA-MB-231, primary human normal breast cells and primary human invasive breast cancer cells were plated into MS culture and treated with a single dose of human recombinant DKK1 (R and D systems) at increasing concentrations (0–100ng/ml).

Techniques: Cell Culture, Control, Generated